UOW small

 

MLST Databases at UoW

WMS logo

Find allele numbers for sequences or st's for allele numbers Browse the strain database Download database contents and programs Population and phylow genetic analyses Primers, pca conditions and curator

Protocols used for MLST of Yersinia pseudotuberculosis


Genes

The Y. pseudotuberculosis MLST scheme uses internal fragments of the following seven house-keeping genes:


adk (adenylate kinase)
argA (N-acetylglutamate synthase)
aroA (3-phosphoshikimate-1-carboxylvinyltransferase)
glnA (glutamine synthase)
thrA (aspartokinase I/homoserine dehydrogenase I)
tmk (thymidylate kinase)
trpE (anthranilate synthase component I)


PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

  Product length:

adk_P1: F 5'-ATGCGTATCATTCTGCTGGG-3'
adk_P2: R 5'-CCGAGAATAGTCGCCAGTTC-3'

641 bp
argA_P1: F 5'-GGATTTCGCCACTCAGTTCC-3'
argA_P2: R 5'-ATCAGTCACCCCTTGTGATG-3'


615 bp
aroA_P3: F 5'-AGCGGCCAATTGGCCATTTG-3'
aroA_P4: R 5'-CACATCGCCATACGGTGGTC-3'


802 bp
glnA_P1: F 5'-GCTGACTTCTTCGAAGAAGG-3'
glnA_P2: R 5'-GACATATGGCAGTGCATACC-3'


701 bp
thrA_P3: F 5'-CGTCTTTGCGGTGATGTCG-3'
thrA_P2: R 5'-GTTGGTGTCATACAAGAATTTACG-3'


823 bp
tmk_P3: F 5'-TATTGAAGGGCTTGAAGGGG-3'
tmk_P4: R 5'-TGATTGGTCAGCCACTGAGC-3'


606 bp
trpE_P3: F 5'-CACCAGTTACAACAAGCGCC-3'
trpE_P4: R 5'-GTATCCAAATCACCGTGAGC-3'
743 bp

An annealing temperature of 55° C is fine for all genes.


Sequencing


adk_S1: F 5'-TGGAGAAATACGGCATTCCG-3'
adk_S2: R 5'-ACATTACGGGTTCCGTCCAG-3'

argA_S3: F 5'-CAAGACATTTGTTGTCATGC-3'
argA_S4: R 5'-ATGGCTAACTGAGTTGCAAC-3'

aroA_S3: F 5'-TGCACAGATCGATTATCTGG-3'
aroA_S2: R 5'-ATGGTCATTGCAGCATCAGG-3'

glnA_S1: F 5'-TTTGATGGCTCCTCGATTGGTG-3'
glnA_S2: R 5'-TTGGTCATGGTATTGAAGCG-3'

thrA_S1: F 5'-GATGTGATGGAACATCTGGC-3'
thrA_S2: R 5'-GTCACCACATGGAAGCCATC-3'

tmk_S5: F 5'-GGCCCAAGGGATTAACGATAT-3'
tmk_S2: R 5'-AATGGGTTGGGAGGCATCAAT-3'

trpE_S1: F 5'-CCAGAGATGGCGTTACAGTG-3'
trpE_S4: R 5'-TAGCCCACTGCACCGCCGTA-3'


Allele template

Allelic profile of Y. pseudotuberculosis strain SP93422.


adk (389 bp):
AAAGCAGGTTCTGAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTTGGTGACTGATGAGTTAGTTATCGCAT
TAGTCAAAGAACGTATCACACAGGAAGATTGCCGCGATGGTTTTCTGTTAGACGGGTTCCCGCGTACCATTCCTCAGGCAGAT
GCCATGAAAGAAGCCGGTATCAAAGTTGATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGG
CCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTACCG
GTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGTCCGTAAGCGTCTTAT

argA (361 bp):
CTAGTATCGTCAACGATATAGGCTTATTACATAGCCTTGGGATCAGATTAGTCGTGGTATACGGTGCCCGACCACAGATTGAC
AGTAATCTGGCAGATCATAACTACGAACCTATTTATCATAAACATACCCGAGTGACTGACGCCCGGACTCTGGAGATGGTCA
AGCAAGCGGCCGGTTTATTACAACTGGATATCACGGCCAGGCTTTCAATGAGTTTGAACAACACCCCACTGCAAGGTGCTCAT
ATCAACGTAGTTAGCGGTAACTTTATCATTGCTCAACCGCTAGGTGTGGATGATGGTGTTGATTATTGCCATAGCGGGCGTATC
CGGCGCATTGATGAAGAAGCTATTCATCG

aroA (357 bp):
TTGATGGGCGTGTCTCTAGCCAGTTCCTGACTGCTTTATTGATGACCGCCCCGCTGGCGGAGCAAGATACGACTATTCGGATT
TGGGTGATCTGGTTTCCAAACCTTATATCGATATTACTCTGCACTTGATGAAAGCATTTGGTATTGACGTGGGGCATGAGAAC
TACCAAATTTTCCACATCAAAGGGGGTCAGACCTACCGCTCACCAGGGACTTATTTGGTTGAGGGCGATGCCTCGTCGGCTTC
CTACTTCTTAGCGGCTGCGGCTATTAAGGGGGGAACAGTGCGTGTCACTGGTATTGGCAAGAAAAGTGTACAGGGCGACACT
AAATTTGCCGATGTGTTGGAAAAAA

glnA (338 bp):
CACTGATTATCCGTTGTGACATTCTTGAGCCAGGCACCATGCAGGGCTATGACCGCGATCCACGTTCTATCTCCAAACGTG
TGAAGACTTCCTGAAATCTTCAGGTATCGCTGATACCGTGTTGTTCGGGCCAGAACCAGAATTCTTCCTGTTTGACGATATC
CGTTTTGGTAGCAGCATCAATGGGTCACACGTATCCATCGATGACGTCGAAGGCGCATGGAACTCCAGCACCAAATACGA
AGGCGGCAACAAAGGCCACCGTCCTGCAGTAAAAGGCGGTTACTTCCCTGTTCCTCCGGTCGACTCTGCACAAGACCTCC
GTTCTGCCATGTGT

thrA (342 bp):
TCAATATTATTGCTATCGCTCAAGGCTCGTCTGAGCGCTCTATTTCTGTGGTTGTCAATAATGATGCGGTCACTACCGGGGTGC
AGTTTGCCACCAGATGCTGTTTAACACGGATCAAGTCATTGAGGTGTTTGTCATTGGCGTGGGTGGTGTGGGGGGCGCATTAA
TCGAACAAATCTATCGCCAGCAACCGTGGTTGAAACAGCGTCATATCGATTTACGTGTTTGTGGTATCGCGAATTCCAAAGCC
ATGTTGACCAACGTGCATGGCATTGCATTAGATAACTGGCGTCAGGAACTGGCTGAAGTTCAGGAGCCGTTTAACCTGAGCC
GCTTGATCC

tmk 375 bp):
AAAACTGCGTGATTTGATTAAGCAAGGTATTGACGGTGAGGTCCTGACGGATAAAGCCGAGGTATTAATGCTGTATGCCG
CCAGGGTGCAATTAGTAGAAAATGTCATCAAGCCAGCACTGGCGCGTGGCAGTTGGGTTGTGGGTGACCGCCATGATTTG
TCATCACAGGCATATCAGGGCGGGGGGCGAGGGATTGACAGCCAACTGATGGCCTCGTTACGTGACACGGTGTTAGGCG
AATTCCGGCCAGACCTGACCTTATATTTGGATCTGCCACCGGCTGTGGGCTTGGCGCGCGCGCGCGCGCGCGGTGAATTGG
ACCGTATCGAACAAGAGTCACTGGCGTTTTTTGAGCGAACCCGCGCACGTTACCT

trpE (465 bp):
CCATCCCGCCGTTTTACGCTGCCCTGCCCATCACCGCTGGCGGCCTATCAGACACTGAAAGACCATAATCCCAGCCCCTAC
ATGTTTTTCATGCAAGACAATGATTTTTCTCTGTTTGGCGCATCACCTGAAAGCGCACTGAAATACGATGCCAGCAACCGT
CAAATTGAGATTTACCCGATTGCGGGTACTCGTCCACGCGGTCGTCGTCCTAATGGAGAACTCGATCGTGATTTAGACAG
CCGTATCGAGTTGGAAATGCGTACTGACCATAAAGAGATGGCAGAACATTTAATGTTGGTGGATCTGGCTCGTAACGATC
TGGCACGTATTTGCGAACCCGGTAGCCGCTATGTTGCAGATTTAACCAAAGTTGACCGTTACTCTTTTGTCATGCATCTGG
TGTCCCGCGTGATTGGCACTCTGCGTCAAGATTTAGATGTGCTGCATGCTTATCAAGCGTGT


 

You are not logged in!



Website and databases managed by Mark Achtman.
Modified by Vimalkumar Velayudhan and Zhemin Zhou

This server is hosted at the University of Warwick.
Development funded by the BBSRC.