UOW small

 

MLST Databases at UoW

WMS logo

Find allele numbers for sequences or st's for allele numbers Browse the strain database Download database contents and programs Population and phylow genetic analyses Primers, pca conditions and curator


Update information 03.01.2013:
The primers that we currently use for medium throughput sequencing are now on this page. This procedure was described in

O'Farrell et al. 2012
Transforming microbial genotyping: A robotic pipeline for genotyping bacterial strains
. PLoS One. 7, e48022.

Update information 26.07.2012:
A description of the MLST scheme and an overview of strains of S. enterica subsp. enterica has now been published and can be downloaded as shown below. This includes an overview of 500 serovars and 138 eBGs.

Achtman,M., Wain,J., Weill,F.-X., Nair,S., Zhou,Z., Sangal,V., Krauland,M.G., Hale,J.L., Harbottle,H., Uebeck,A., Dougan,J., Harrison,L.H., Brisse,S., S. enterica MLST Study Group. 2012. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathogens. 8, e1002776.

Update information 01.02.2012:
There has been a major change in the information content of the S. enterica database. Two fields are now included, eBG and Lineage, which were previously absent. eBG is an acronym for eBurstGroup, and is equivalent to ST Complex or Clonal Complex in other bacterial MLST schemes. STs were assigned to a common eBG if an ST contained 10 or more isolates or there were at least 2 STs linked by identity at 6/7 alleles (so-called Single Locus Variants). Some double locus variants STs were affiliated with an existing eBG if they contained the same serovar. The field "Lineage" indicates which isolates are in Lineage 3, which was defined by Didelot et al., in PLoS Pathogens 7: e1002191 (2011). Lineage 3 is equivalent to Clade B in prior publications by Didelot and Gordon. An assignment to Lineage 3 was performed on the basis of a BAPS analysis.

Update information 27.05.2008:
The database has >2,300 entries currently and some mistaken information has been corrected in the last few weeks. New primers are being listed today for strains for which it is difficult to obtain PCR products or clean sequences. These can be combined in various combinations with the pre-existing primers. The database home is in the process of being moved to UCC, Cork and we hope to finally begin soon on a long needed update of the interface and functionality.

Update information 24.08.2005:
Sylvain Brisse has developed new variants of the primers for amplification which consist of the same primers listed below except that the 5' end contains an added universal primer that is also used for sequencing. Amplification is at the same temperature of 55. These added universal primers consist of Forwards: GTTTTCCCAGTCACGACGTTGTA and Reverse: TTGTGAGCGGATAACAATTTC. These primers have the advantage that it is possible to sequence more reactions with a common primer. Our experience has been generally positive except that it is now easier to cross contaminate across wells.

Update information:
Major changes have been made related to strains within the SARB collection as documented in Changes 18.01.2005

A summary of the currently known properties of the SARB and parts of the SARA collections within the laboratories of Ken Sanderson, Howard Ochman and Fidelma Boyd can be seen at SarA SarB Summary

Protocols used for MLST of Salmonella enterica


Genes

The S. enterica MLST scheme uses internal fragments of the following seven house-keeping genes:


thrA (aspartokinase+homoserine dehydrogenase)
purE (phosphoribosylaminoimidazole carboxylas)
sucA (alpha ketoglutarate dehydrogenase)
hisD (histidinol dehydrogenase)
aroC (chorismate synthase)
hemD (uroporphyrinogen III cosynthase)
dnaN (DNA polymerase III beta subunit)


PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

  Product length:

thrA: F 5'-GTCACGGTGATCGATCCGGT-3' recommended
thrA: R 5'-CACGATATTGATATTAGCCCG-3' recommended
thrA: R1 5'-GTGCGCATACCGTCGCCGAC-3' (also Seq)

852 bp
purE: F 5'-ATGTCTTCCCGCAATAATCC-3'
purE: F1 5'-GACACCTCAAAAGCAGCGT'-3' recommended
purE: R 5'-TCATAGCGTCCCCCGCGGATC-3'
purE: R1 5'-CGAGAACGCAAACTTGCTTC-3'
purE: R2 5'-AGACGGCGATACCCAGCGG-3' recommended

510 bp
sucA: F 5'-AGCACCGAAGAGAAACGCTG-3'
sucA: F1 5'-CGCGCTCAAACAGACCTAC-3' recommended
sucA: R 5'-GGTTGTTGATAACGATACGTAC-3'
sucA: R1 5'-GACGTGGAAAATCGGCGCC-3' recommended


643 bp
hisD: F 5'-GAAACGTTCCATTCCGCGCAGAC-3'
hisD: F1 5'-GAAACGTTCCATTCCGCGC-3' recommended
hisD: R 5'-CTGAACGGTCATCCGTTTCTG-3'
hisD: R1 5-GCGGATTCCGGCGACCAG-3' recommended


894 bp
aroC: F 5'-CCTGGCACCTCGCGCTATAC-3' recommended
aroC: R 5'-CCACACACGGATCGTGGCG-3' recommended


826 bp
hemD: F 5'-ATGAGTATTCTGATCACCCG-3'
hemD: F1 5'-GAAGCGTTAGTGAGCCGTCTGCG-3' recommended
hemD: R 5'-ATCAGCGACCTTAATATCTTGCCA-3' recommended


666 bp
dnaN: F 5'-ATGAAATTTACCGTTGAACGTGA-3'
dnaN: R 5'-AATTTCTCATTCGAGAGGATTGC-3' recommended
dnaN: R1 5'-CCGCGGAATTTCTCATTCGAG-3' recommended (also Seq)
833 bp

An annealing temperature of 55° C is fine for all genes.


Sequencing

Together with the recommended PCR primers above, we recommend using the following sequencing primers at 50C
aroC: aroC_sF1(GGCGTGACGACCGGCAC) and aroC_sR1 (AGCGCCATATGCGCCAC)
dnaN: dnaN_sF (CCGATTCTCGGTAACCTGCT) and dnaN_sR1 (ACGCGACGGTAATCCGGG)
hemD: hemD_sF2 (GCCTGGAGTTTTCCACTG) and hemd_sR (GACCAATAGCCGACAGCGTAG)
hisD: hisD_sF (GTCGGTCTGTATATTCCCGG) and hisD_sR (GGTAATCGCATCCACCAAATC)
purE: purE_sF1 (ACAGGAGTTTTAAGACGCATG) and purE_sR1 (GCAAACTTGCTTCATAGCG)
sucA: sucA_sF1 (CCGAAGAGAAACGCTGGATC) and sucA_sR (GGTTGTTGATAACGATACGTAC)
thrA: thrA_sF (ATCCCGGCCGATCACATGAT) and thrA_sR1 (ACCGCCAGCGGCTCCAGCA)


Our previous recommendations were to use the PCR primers for sucA, thrAR1 and dnaNR1 for sequencing as well as the other primers listed below:

thrA: sF 5'-ATCCCGGCCGATCACATGAT-3'
thrA: sR 5'-CTCCAGCAGCCCCTCTTTCAG-3'

purE: sF 5'-CGCATTATTCCGGCGCGTGT-3'
purE: sF1 5'-CGCAATAATCCGGCGCGTGT-3'
purE: sR 5'-CGCGGATCGGGATTTTCCAG-3'
purE: sR1 5'-GAACGCAAACTTGCTTCAT-3'

sucA: sF 5'-AGCACCGAAGAGAAACGCTG-3'
sucA: sR 5'-GGTTGTTGATAACGATACGTAC-3'

hisD: sF 5'-GTCGGTCTGTATATTCCCGG-3'
hisD: sR 5'-GGTAATCGCATCCACCAAATC-3'

aroC: sF 5'-GGCACCAGTATTGGCCTGCT-3'
aroC: sR 5'-CATATGCGCCACAATGTGTTG-3'

hemD: sF 5'-GTGGCCTGGAGTTTTCCACT-3'
hemD: sF1 5'-ATTCTGATCACCCGCCCCTC-3'
hemD: sR 5'-GACCAATAGCCGACAGCGTAG-3'

dnaN: sF 5'-CCGATTCTCGGTAACCTGCT-3'
dnaN: sR 5'-CCATCCACCAGCTTCGAGGT-3'


Allele template

Allelic profile of S. typhi strain CT18.


thrA (501 bp):
GTGCTGGGCCGTAATGGTTCCGACTATTCCGCCGCCGTGCTGGCCGCCTGTTTACGCGCTGACTGCTGTGAAATCTGGACTGACGT
CGATGGCGTGTATACCTGTGACCCGCGCCAGGTGCCGGACGCCAGGCTGTTGAAATCGATGTCCTACCAGGAAGCGATGGAGCTCT
CTTACTTCGGCGCTAAAGTCCTTCACCCTCGCACCATAACGCCTATCGCCCAGTTCCAGATCCCCTGTCTGATTAAAAATACCGGC
AATCCGCAGGCGCCAGGAACGCTGATCGGCGCGTCCAGCGACGATGATAATCTGCCGGTTAAAGGGATCTCTAACCTTAACAACAT
GGCGATGTTTAGCGTCTCCGGCCCGGGAATGAAAGGGATGATTGGGATGGCGGCGCGTGTTTTCGCCGCCATGTCTCGCGCCGGGA
TCTCGGTGGTGCTCATTACCCAGTCCTCCTCTGAGTACAGCATCAGCTTCTGTGTGCCGCAGAGTGACTGC

purE (399 bp):
AGCGACTGGGCTACCATGCAATTCGCCGCCGAAATTTTTGAAATTCTGGATGTCCCGCACCATGTAGAAGTGGTTTCCGCCCATCG
CACCCCCGATAAACTGTTCAGCTTCGCCGAAACGGCGGAAGAGAACGGATATCAAGTGATTATTGCCGGCGCGGGCGGCGCGGCAC
ACCTGCCGGGAATGATTGCGGCAAAAACGCTGGTCCCGGTACTCGGCGTGCCGGTACAAAGCGCTGCGCTCAGCGGCGTGGATAGC
CTCTACTCCATCGTGCAGATGCCGCGCGGCATTCCGGTGGGTACGCTGGCGATCGGTAAAGCCGGGGCGGCGAACGCCGCACTGCT
GGCAGCGCAAATTTTGGCTACGCATGATAGCGCGCTGCATCGGCGCATCGCCGAC

sucA (501 bp):
AAACGCTTCCTGAACGAACTGACCGCCGCTGAAGGGCTGGAACGTTATCTGGGCGCCAAATTCCCGGGTGCGAAACGTTTCTCGCT
CGAGGGGGGAGATGCGCTGATACCTATGCTGAAAGAGATGGTTCGCCATGCGGGTAACAGCGGCACTCGCGAAGTGGTGCTGGGGA
TGGCGCACCGCGGTCGTCTGAACGTGCTGATCAACGTACTGGGTAAAAAACCGCAGGATCTGTTCGACGAGTTTGCCGGTAAACAT
AAAGAACATCTGGGTACCGGCGACGTGAAGTATCACATGGGCTTCTCGTCAGATATCGAAACTGAAGGCGGTCTGGTTCACCTGGC
GCTGGCGTTTAACCCATCGCATCTGGAAATTGTGAGCCCGGTGGTGATGGGCTCCGTGCGCGCCCGTCTGGACCGACTGGACGAAC
CGAGCAGTAATAAAGTGCTGCCGATCACTATTCACGGCGACGCCGCGGTGACCGGCCAGGGCGTGGTTCAG

hisD (501 bp):
ATTGCGGGATGCCAGAAGGTGGTTCTGTGCTCGCCGCCACCCATCGCTGATGAAATCCTCTATGCGGCGCAACTGTGTGGCGTGCA
GGAAATCTTTAACGTCGGCGGCGCGCAGGCGATTGCCGCTCTGGCCTTCGGCAGCGAGTCCGTACCGAAAGTGGATAAAATTTTTG
GCCCCGGCAACGCCTTTGTAACCGAAGCCAAGCGTCAGGTCAGCCAGCGTCTCGACGGCGCGGCTATCGATATGCCAGCCGGGCCG
TCTGAAGTGCTGGTGATCGCCGACAGCGGCGCAACACCGGATTTCGTCGCTTCTGACCTGCTCTCCCAGGCTGAGCACGGCCCGGA
TTCCCAGGTGATCCTGCTGACGCCGGATGCTGACATTGCCCGCAAGGTGGCGGAGGCGGTAGAACGTCAACTGGCGGAACTGCCGC
GCGCGGGCACCGCCCGGCAGGCCCTGAGCGCCAGTCGTCTGATTGTGACCAAAGATTTAGCGCAGTGCGTC

aroC (501 bp):
GTTTTTCGCCCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGCGGCGGTGGACGTTCTTCCGCGCG
TGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACTTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGA
CCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTCTTTTGCCCCGATGCGGACAAACTT
GACGCGCTGGACGAACTGATGCGCGCGCTGAAAAAAGAGGGTGACTCCATCGGCGCGAAAGTGACGGTGATGGCGAGCGGCGTGCC
GGCAGGGCTTGGCGAACCGGTATTTGACCGACTGGATGCGGACATCGCCCATGCGCTGATGAGCATCAATGCGGTGAAAGGCGTGG
AGATCGGCGAAGGATTTAACGTGGTGGCGCTGCGCGGCAGCCAGAATCGCGATGAAATCACGGCGCAGGGT

hemD (432 bp):
GCAACGCTGACGGAAAACGATCTGGTTTTTGCCCTTTCACAGCACTCCGTCGCCTTTGCTCACGCCCAGCTCCAGCGGGATGGACG
AAACTGGCCTGCGTCGCCGCGCTATTTCTCGATTGGCCGCACCACGGCGCTCGCCCTTCATACCGTTAGCGGGTTCGATATTCGTT
ATCCATTGGATCGGGAAATCAGCGAAGCCTTGCTACAATTACCTGAATTACAAAATATTGCGGGCAAACGCGCGCTGATTTTGCGT
GGCAATGGCGGCCGCGAACTGCTGGGCGAAACCCTGACAGTTCGCGGAGCCGAAGTCAGTTTTTGTGAATGTTATCAACGATGTGC
GAAACATTACGATGGCGCGGAAGAAGCGATGCGCTGGCATACTCGCGGCGTAACAACGCTTGTTGTTACCAGCGGCGAGATGTTGC
AA

dnaN (501 bp):
ATGGAGATGGTCGCGCGCGTTACGCTTTCTCAGCCGCATGAGCCAGGCGCCACTACCGTGCCGGCGCGGAAATTCTTTGATATCTG
CCGCGGCCTGCCGGAGGGCGCGGAGATTGCCGTTCAGTTGGAAGGCGATCGGATGCTGGTGCGTTCTGGCCGTAGCCGCTTCTCGC
TGTCTACGCTGCCTGCCGCCGATTTCCCGAATCTTGACGACTGGCAAAGCGAAGTTGAATTTACGCTGCCGCAGGCCACGATGAAG
CGCCTGATTGAAGCGACCCAGTTTTCGATGGCCCATCAGGATGTGCGCTACTACTTAAACGGTATGCTGTTTGAAACGGAAGGTAG
CGAACTGCGCACTGTTGCGACCGACGGCCACCGTCTGGCGGTGTGCTCAATGCCGCTGGAGGCGTCTTTACCTAGCCACTCGGTGA
TTGTGCCGCGTAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGTGGCGAAAACCCGCTGCGCGTGCAG


 

You are not logged in!



Website and databases managed by Mark Achtman.
Modified by Vimalkumar Velayudhan and Zhemin Zhou

This server is hosted at the University of Warwick.
Development funded by the BBSRC.