UOW small

 

MLST Databases at UoW

WMS logo

Find allele numbers for sequences or st's for allele numbers Browse the strain database Download database contents and programs Population and phylow genetic analyses Primers, pca conditions and curator


For citation please refer to: Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L.H., Karch, H., Reeves, P. R., Maiden, M. C., Ochman, H., and Achtman M. 2006. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol.Microbiol. 60(5), 1136-1151.

Update information: ST complexes have been updated again on 17.05.2007. There are currently 600 STs and 54 ST complexes. The criteria have also been changed and are now groups of at least 3 STs sharing 6 alleles in pair-wise comparisons. The assignments of STs to some of the previous ST complexes have changed as a result, although we have tried to maintain consistency.

ST complexes have been updated again on 24.08.2005. Multiple new ST Complexes have been assigned and multiple STs have been assigned to known complexes. Due to the increased number of strains assigned to the ST29 Complex, it has become unclear whether these bacteria are closely related or only linked by one intermediate recombinant. Therefore, this has now been split into the ST23 and ST29 Complexes.

ST complexes have been updated on 23.11.2004. This includes the merging of ST21, 29 and 90 Complexes into ST29 Complex and ST3 and 17 Complexes into ST20 Complex. Multiple new ST complexes have been assigned. A number of STs have been merged with other STs due to curation of the database.


Protocols used for MLST of Escherichia coli



Genes

The E. coli MLST scheme uses internal fragments of the following seven house-keeping genes:

adk (adenylate kinase)
fumC (fumarate hydratase)
gyrB (DNA gyrase)
icd (isocitrate/isopropylmalate dehydrogenase)
mdh (malate dehydrogenase)
purA (adenylosuccinate dehydrogenase)
recA (ATP/GTP binding motif)


PCR Amplification

Please note: These include new primer sequences (added 26 July 2004; labelling corrected on 5 March, 2007) whose labels indicate the genomic direction rather than reading frame.
The primer pairs for the PCR amplification of internal fragments of these genes can be chosen from:



Gene: Product length: Annealing Temperature:

adkF 5'-ATTCTGCTTGGCGCTCCGGG-3'
adkR 5'-CCGTCAACTTTCGCGTATTT-3'
adkF1 5'-TCATCATCTGCACTTTCCGC-3'
adkR1 5'-CCAGATCAGCGCGAACTTCA-3'

583 bp 54° C
fumCR1 5'-TCCCGGCAGATAAGCTGTGG-3'
fumCF 5'-TCACAGGTCGCCAGCGCTTC-3'
fumCR 5'-GTACGCAGCGAAAAAGATTC-3'


806 bp 54° C
gyrBF 5'-TCGGCGACACGGATGACGGC-3'
gyrBR1 5'-GTCCATGTAGGCGTTCAGGG-3'
gyrBR 5'-ATCAGGCCTTCACGCGCATC-3'


911 bp 60° C
icdF 5'-ATGGAAAGTAAAGTAGTTGTTCCGGCACA-3'
icdR 5'-GGACGCAGCAGGATCTGTT-3'


878 bp 54° C
mdhF 5'-ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG-3'
mdhR 5'-TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT-3'
mdhF1 5'-AGCGCGTTCTGTTCAAATGC-3'
mdhR1 5'-CAGGTTCAGAACTCTCTCTGT-3'


932 bp 60° C
purAF1 5'-TCGGTAACGGTGTTGTGCTG-3'
purAF 5'-CGCGCTGATGAAAGAGATGA-3'
purAR 5'-CATACGGTAAGCCACGCAGA-3'


816 bp 54° C
recAR1 5'-AGCGTGAAGGTAAAACCTGTG-3'
recAF 5'-CGCATTCGCTTTACCCTGACC-3'
recAF1 5'-ACCTTTGTAGCTGTACCACG-3'
recAR 5'-TCGTCGAAATCTACGGACCGGA-3'
780 bp 58° C

Conditions:

PCR: 2 min at 95°, 30 cycles of 1 min at 95°, 1 min at annealing temp, 2 min at 72° followed by 5 min at 72°. The PCR reaction contains 50 ng of chromosomal DNA, 20 pmol of each primer, 200 umol (10 ul of a 2 mM solution) of the dNPTs, 10 ul of 10x PCR buffer, 5 units of Taq polymerase and water to 100 ul.


Sequencing


We use the amplification primer pairs for the sequencing step.

Allele template

Allelic profile of E. coli strain MG1655 (see Genebank)

adk (536 bp):
GGGGAAAGGGACTCAGGCTCAGTTCATCATGGAGAAATATGGTATTCCGCAAATCTCCACTGGCGATATGCTGCGTG
CTGCGGTCAAATCTGGCTCCGAGCTGGGTAAACAAGCAAAAGACATTATGGATGCTGGCAAACTGGTCACCGACGAA
CTGGTGATCGCGCTGGTTAAAGAGCGCATTGCTCAGGAAGACTGCCGTAATGGTTTCCTGTTGGACGGCTTCCCGCG
TACCATTCCGCAGGCAGACGCGATGAAAGAAGCGGGCATCAATGTTGATTACGTTCTGGAATTCGACGTACCGGACG
AACTGATCGTTGACCGTATCGTCGGTCGCCGCGTTCATGCGCCGTCTGGTCGTGTTTATCACGTTAAATTCAATCCG
CCGAAAGTAGAAGGCAAAGACGACGTTACCGGTGAAGAACTGACTACCCGTAAAGATGATCAGGAAGAGACCGTACG
TAAACGTCTGGTTGAATACCATCAGATGACAGCACCGCTGATCGGCTACTACTCCAAAGAAGCAGAAGCGGGTA

fumC (469 bp):
CGAGCGCCATTCGTCAGGCGGCGGATGAAGTACTGGCAGGACAGCATGACGACGAATTCCCGCTGGCTATCTGGCAG
ACCGGCTCCGGCACGCAAAGTAACATGAACATGAACGAAGTGCTGGCTAACCGGGCCAGTGAATTACTCGGCGGTGT
GCGCGGGATGGAACGTAAAGTTCACCCTAACGACGACGTGAACAAAAGCCAAAGTTCCAACGATGTCTTTCCGACGG
CGATGCACGTTGCGGCGCTGCTGGCGCTGCGCAAGCAACTCATTCCTCAGCTTAAAACCCTGACACAGACACTGAAT
GAGAAATCCCGTGCTTTTGCCGATATCGTCAAAATTGGTCGTACTCACTTGCAGGATGCCACGCCGTTAACGCTGGG
GCAGGAGATTTCCGGCTGGGTAGCGATGCTCGAGCATAATCTCAAACATATCGAATACAGCCTGCCTCACGTAGCGG
AACTGGC

gyrB (460 bp):
GGTCTGCACGGCGTTGGTGTTTCGGTAGTAAACGCCCTGTCGCAAAAACTGGAGCTGGTTATCCAGCGCGAGGGTAA
AATTCACCGTCAGATCTACGAACACGGTGTACCGCAGGCCCCGCTGGCGGTTACCGGCGAGACTGAAAAAACCGGCA
CCATGGTGCGTTTCTGGCCCAGCCTCGAAACCTTCACCAATGTGACCGAGTTCGAATATGAAATTCTGGCGAAACGT
CTGCGTGAGTTGTCGTTCCTCAACTCCGGCGTTTCCATTCGTCTGCGCGACAAGCGCGACGGCAAAGAAGACCACTT
CCACTATGAAGGCGGCATCAAGGCGTTCGTTGAATATCTGAACAAGAACAAAACGCCGATCCACCCGAATATCTTCT
ACTTCTCCACTGAAAAAGACGGTATTGGCGTCGAAGTGGCGTTGCAGTGGAACGATGGCTTCCAGGAAAACATCT

icd (518 bp):
CGACGCTGCAGTCGAGAAAGCCTATAAAGGCGAGCGTAAAATCTCCTGGATGGAAATTTACACCGGTGAAAAATCCA
CACAGGTTTATGGTCAGGACGTCTGGCTGCCTGCTGAAACTCTTGATCTGATTCGTGAATATCGCGTTGCCATTAAA
GGTCCGCTGACCACTCCGGTTGGTGGCGGTATTCGCTCTCTGAACGTTGCCCTGCGCCAGGAACTGGATCTCTACAT
CTGCCTGCGTCCGGTACGTTACTATCAGGGCACTCCAAGCCCGGTTAAACACCCTGAACTGACCGATATGGTTATCT
TCCGTGAAAACTCGGAAGACATTTATGCGGGTATCGAATGGAAAGCTGACTCTGCCGACGCCGAGAAAGTGATTAAA
TTCCTGCGTGAAGAGATGGGCGTGAAGAAAATTCGCTTCCCGGAACATTGCGGTATCGGTATTAAGCCGTGTTCTGA
AGAAGGCACCAAACGTCTGGTTCGTGCAGCGATCGAATACGCAATTGCTAACGATC

mdh (452 bp):
GGCGTAGCGCGTAAACCGGGTATGGATCGTTCCGACCTGTTTAACGTTAACGCCGGCATCGTGAAAAACCTGGTACA
GCAAGTTGCGAAAACCTGCCCGAAAGCGTGCATTGGTATTATCACTAACCCGGTTAACACCACAGTTGCAATTGCTG
CTGAAGTGCTGAAAAAAGCCGGTGTTTATGACAAAAACAAACTGTTCGGCGTTACCACGCTGGATATCATTCGTTCC
AACACCTTTGTTGCGGAACTGAAAGGCAAACAGCCAGGCGAAGTTGAAGTGCCGGTTATTGGCGGTCACTCTGGTGT
TACCATTCTGCCGCTGCTGTCACAGGTTCCTGGCGTTAGTTTTACCGAGCAGGAAGTGGCTGATCTGACCAAACGCA
TCCAGAACGCGGGTACTGAAGTGGTTGAAGCGAAGGCCGGTGGCGGGTCTGCAACCCTGTCTATGGG


purA (478 bp):
ATAACGCGCGTGAGAAAGCGCGTGGCGCGAAAGCGATCGGCACCACCGGTCGTGGTATCGGGCCTGCTTATGAAGAT
AAAGTAGCACGTCGCGGTCTGCGTGTTGGCGACCTTTTCGACAAAGAAACCTTCGCTGAAAAACTGAAAGAAGTGAT
GGAATATCACAACTTCCAGTTGGTTAACTACTACAAAGCTGAAGCGGTTGATTACCAGAAAGTTCTGGATGATACGA
TGGCTGTTGCCGACATCCTGACTTCTATGGTGGTTGACGTTTCTGACCTGCTCGACCAGGCGCGTCAGCGTGGCGAT
TTCGTCATGTTTGAAGGTGCGCAGGGTACGCTGCTGGATATCGACCACGGTACTTATCCGTACGTAACTTCTTCCAA
CACCACTGCTGGTGGCGTGGCGACCGGTTCCGGCCTGGGCCCGCGTTATGTTGATTACGTTCTGGGTATCCTCAAAG
CTTACTCCACTCGTGT

recA (510 bp):
CGCACGTAAACTGGGCGTCGATATCGACAACCTGCTGTGCTCCCAGCCGGACACCGGCGAGCAGGCACTGGAAATCT
GTGACGCCCTGGCGCGTTCTGGCGCAGTAGACGTTATCGTCGTTGACTCCGTGGCGGCACTGACGCCGAAAGCGGAA
ATCGAAGGCGAAATCGGCGACTCTCACATGGGCCTTGCGGCACGTATGATGAGCCAGGCGATGCGTAAGCTGGCGGG
TAACCTGAAGCAGTCCAACACGCTGCTGATCTTCATCAACCAGATCCGTATGAAAATTGGTGTGATGTTCGGTAACC
CGGAAACCACTACCGGTGGTAACGCGCTGAAATTCTACGCCTCTGTTCGTCTCGACATCCGTCGTATCGGCGCGGTG
AAAGAGGGCGAAAACGTGGTGGGTAGCGAAACCCGCGTGAAAGTGGTGAAGAACAAAATCGCTGCGCCGTTTAAACA
GGCTGAATTCCAGATCCTCTACGGCGAAGGTATCAACTTCTACGGCGA


 

You are not logged in!



Website and databases managed by Mark Achtman.
Modified by Vimalkumar Velayudhan and Zhemin Zhou

This server is hosted at the University of Warwick.
Development funded by the BBSRC.